Reference no: EM13974315
Questions: Provide specific answers in your own words. Be as detailed and specific as possible.
1. Provide several reasons why you might choose to express a protein in a prokaryotic system.
2. Provide several reasons why you might choose to express a protein in a eukaryotic system.
3. The PCR that your labmate designed is resulting in virtually no amplification. Her amplification conditions look OK, so you suspect there might be a problem with the design of her primers. What seems to be the source of the issue with her PCR? If possible, also include a diagram illustrating your answer. (Hand-drawn is OK if you are unable to generate a computerized
imageForward Primer: Reverse Primer:
5'- TGGACCTGGCAATACTCAGG -3' 5'- ACTCCTAGCAACGGTGAACT -3'
4. Your labmate had his headphones in and was jamming out to 1989, Taylor Swift's latest album, so he wasn't really paying attention when he set up his electrophoresis gel. You walked into the room just as he turned on the power button. What's wrong with the setup he used? What will happen if the gel is allowed to run? Why? (Hint: You only have about 2 minutes to correct his mistake before it's too late and he'll have to start all over again!)
Adapted from: Campbell, M., & Farrell, S. (2012). Biochemistry (7th ed.). Belmont, CA: Brooks/Cole, Cengage Learning.
5. You have received a sample of a new pathogen with a 10 kb genome. In order to obtain preliminary information on its genome organization, you perform restriction enzyme digestion using HindIII and Sau3AI individually as well as in combination. Provide an explanation describing and/or diagram showing the location of the HindIII and Sau3AI cut sites within the genome. (Note that one band in the double digest is twice as bright as all the other bands
6. The use of synthetic biology to develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic "calculations" and respond in specific ways under specific predetermined conditions.
a) The results from logic gates can be represented in what is known as a "truth table". The two input conditions are listed (0 = off; 1 = on), along with the output condition. For a molecular AND gate, fill in the output condition in the truth table below.
A
|
B
|
Output
|
0
|
0
|
?
|
0
|
1
|
?
|
1
|
0
|
?
|
1
|
1
|
?
|
b) Just like a molecular AND gate produces its output when both input A and B are present, a molecular OR gate produces its output when either input A or B are present:
A
|
B
|
Output
|
0
|
0
|
0
|
0
|
1
|
1
|
1
|
0
|
1
|
1
|
1
|
1
|
With that knowledge, examine the composite logic gate below, which is made up of an AND gate and an OR gate, the outputs of which each feed into another AND gate.
If the inputs for the initial gates are controlled by the inducing chemicals A, B, C, and D (absence of the chemical = 0; presence of the chemical = 1), construct a truth table for the composite logic gate. (Hint: there are 16 possible input combinations.)
What was real per capita gdp in 1933 measured in 2013 prices
: How do you find the answer for this question. Please elaborate. What was real per capita GDP in 1933 measured in 2013 prices? Use the data in the table below and a price index of 100/1,400 to compute your answer
|
Identify the costs associated with going public
: Identify the costs associated with going public. Briefly describe how investment banking is regulated.
|
Bob''s willingness to trade one good for the other
: Suppose that Bob's indifference curves are perfectly L-shaped with the right angel occurring when Bob has equal amounts of both goods. What does this imply about Bob's willingness to trade one good for the other? Give examples of goods where this ty..
|
The highland commodities company is a typical firm
: The Highland Commodities Company is a typical firm in a perfectly competitive market has a cost structure described by the equation: C = 25 - 4QF + Q2F where QF is measured in thousands of units.
|
Express a protein in a prokaryotic system
: develop molecular logic gates has allowed the design of complex synthetic genetic pathways with myriad combinations and applications possible. Now organisms can be engineered to perform genetic "calculations" and respond in specific ways under spe..
|
What modification could odelia make to increase iron content
: What modifications could Odelia make to increase the iron content of her dinner? Does Odelia's diet meet the recommendations of the Food Guide Pyramid for vegetarians?
|
Discuss the 3 important characteristics of life insurance
: Please define each of the followingand provide one scenario in which each plan or type of coverage would be appropriate.
|
What are perfect subtitutes
: 1.What are perfect subtitutes? Give some real world examples. What dotheir indifference curves look like? Can you give a utility function for perfectsubstitutes? 2.What are perfect complements? Give some real world examples. What dotheir indifference..
|
Why is the marginal cost curve the supply curve
: Why is the marginal cost curve the supply curve for a firm that maximizes it profits? Explain your answer with a graph. Show the areas of profits for any price that the firm may face. (6)Let's pretend that you are in the competitive shelter-building..
|