User Account

All Pages

Explanation of how overexpression

Assignment Help Biology
Reference no: EM131051915

Glioblastoma multiforme is a highly malignant form of brain cancer. MicroRNA-21 (miR-21) is overexpressed 100-fold in glioblastoma compared to normal cells. Choose from below the most correct explanation of how overexpression of a microRNA could lead to malignancy.
b. miR-21 suppresses translation of tumor suppressor mRNA.
c. miR-21 activates translation of a cellular maintenance mRNA.
d. miR-21 activates translation of tumor suppressor mRNA.

Reference no: EM131051915

Questions Cloud

Compare the two projects in terms of general progress : Industrial Building, Inc., has two project teams installing virtually identical, 4-story commercial buildings for a customer in two separate cities.
Offspring of the two population : Examine the two squirrel populations in the following figure. the populations are separated by a geographic barrier. if after a long period of the time the two species are no longer separated what evidence is needed to determine if speciation has ..
Unknown animal from the seafloor : Imagine that you are a marine biologist. As part of your exploration you dredge up an unknown animal from the seafloor. Describe some of the characteristics you should look to determine the phylum to which the creature should be assigned.
Apply in both private and public organizations : The U.S. Supreme Court ruled that cities could have school voucher programs that give money directly to parents, who could then choose among competing schools, public or private.
Explanation of how overexpression : Glioblastoma multiforme is a highly malignant form of brain cancer. MicroRNA-21 (miR-21) is overexpressed 100-fold in glioblastoma compared to normal cells. Choose from below the most correct explanation of how overexpression of a microRNA could l..
How can ground water contamination be prevented : Explain the difference between chemical and physical weathering. What processes can cause originally solid rock to break in pieces? Explain the process of soil formation. Why do soils develop distinct horizons? Explain the difference between a sta..
Breast cancer also lost expression of one copy : Carrying a mutation in one copy of the BRCA1 gene leads to increased risk of developing breast and/or ovarian cancer because as a woman ages, she risks mutating the other copy of the BRCA1 gene.
Compare inventory costing method and current gaap standards : For the company IBM compare and contrast the following pronouncements and the current GAAP standards: Inventory costing method (IAS2), Valuation of the property plant and equipment (IAS16) and Fair value measurement standards (IFRS 13)
Write about feminist theory : Write 250 words each of given topics: English school, Feminist theory and Critical theory marxists

Reviews

Write a Review

 

Biology Questions & Answers

  Find minimum number of ridge producing genes

If an AaBBCcdd male ma of ridge-producing genes possible in one of their children? What is the minimum number of ridge-producing genes possible in a child of this couple?

  Explain how is enzyme activity regulated by the cell

Describe how these two processes are linked between plants and animals based on the reactants and products (water, carbon dioxide, glucose and oxygen) of both pathways.

  Present at a higher concentration outside of cells

Suppose substance X is present at a higher concentration outside of cells, and that after a time its concentration inside cells increases.  What must you know to tell if substance X is diffusing through the phospholipid layers of the membrane, diffus..

  Definition of the problem-hypothesis

You need to develope an experiment to test your product. you have thirty volunteers with colds to help you. Include the following parts. Definition of the problem, Hypothesis, Variable, control procedure and experimental procedure.

  Discussing the classification of viruses

Write a one to two page essay discussing the classification of viruses with the 6 kingdoms of life. Which kingdom, if any, do they belong in? Why do they belong or not belong there?

  Discuss how a system structure relates to function

When you look around at the world, you can see various examples that show how an object's or a system's structure relates to its function.

  What colors are the butterflies

What colors are the butterflies and What colors are the flowers? Do the colors you see correspond to those selected in Box 1 of the Settings panel at the top of the simulation? Explain

  Discuss the structure of the horse industry

Compare and contrast it with the other animal industries discussed thus far. Please discuss two things your learned or found interesting during your tour of the OSU Horse Center.

  Why are frameshift mutations insertions and deletions more

1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

  Estimate ph of the mixture

A reactio mixture containing 20 mM O-acetly serine, fifty mM NaCl, 50 mM HEPES buffer (pH 7.6), and O-acetyl serine is incubated at 37 C until the O-acetyl serine is completely hydrolyzed.

  Both photosynthesis and aerobic cellular respiration

Both photosynthesis and aerobic cellular respiration are examples of complex metaoblic pathways, consisting of many chemical reactions that require enzymes to function. Explain two attributes of enzymes in catalyzing chemical reactions and in metabol..

  How the first eukaryotic cell may have developed

A model that describes how the first eukaryotic cell may have developed. It is two words the first with twelve letters and thesecond has ten letters.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd