Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Glioblastoma multiforme is a highly malignant form of brain cancer. MicroRNA-21 (miR-21) is overexpressed 100-fold in glioblastoma compared to normal cells. Choose from below the most correct explanation of how overexpression of a microRNA could lead to malignancy.b. miR-21 suppresses translation of tumor suppressor mRNA.c. miR-21 activates translation of a cellular maintenance mRNA.d. miR-21 activates translation of tumor suppressor mRNA.
If an AaBBCcdd male ma of ridge-producing genes possible in one of their children? What is the minimum number of ridge-producing genes possible in a child of this couple?
Describe how these two processes are linked between plants and animals based on the reactants and products (water, carbon dioxide, glucose and oxygen) of both pathways.
Suppose substance X is present at a higher concentration outside of cells, and that after a time its concentration inside cells increases. What must you know to tell if substance X is diffusing through the phospholipid layers of the membrane, diffus..
You need to develope an experiment to test your product. you have thirty volunteers with colds to help you. Include the following parts. Definition of the problem, Hypothesis, Variable, control procedure and experimental procedure.
Write a one to two page essay discussing the classification of viruses with the 6 kingdoms of life. Which kingdom, if any, do they belong in? Why do they belong or not belong there?
When you look around at the world, you can see various examples that show how an object's or a system's structure relates to its function.
What colors are the butterflies and What colors are the flowers? Do the colors you see correspond to those selected in Box 1 of the Settings panel at the top of the simulation? Explain
Compare and contrast it with the other animal industries discussed thus far. Please discuss two things your learned or found interesting during your tour of the OSU Horse Center.
1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of
A reactio mixture containing 20 mM O-acetly serine, fifty mM NaCl, 50 mM HEPES buffer (pH 7.6), and O-acetyl serine is incubated at 37 C until the O-acetyl serine is completely hydrolyzed.
Both photosynthesis and aerobic cellular respiration are examples of complex metaoblic pathways, consisting of many chemical reactions that require enzymes to function. Explain two attributes of enzymes in catalyzing chemical reactions and in metabol..
A model that describes how the first eukaryotic cell may have developed. It is two words the first with twelve letters and thesecond has ten letters.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd