Experiences of lower back pain

Assignment Help Other Subject
Reference no: EM1361873

A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

Reference no: EM1361873

Questions Cloud

What is the speed of lander just before it touches surface : Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative ..
Multiple regression model and independent variables : Propose a business problem that would be best solved by multiple regression analysis. How would you evaluate the quality of the multiple regression model?
Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?
Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.
Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.
Calculate the bond price : Consider an America Off Line thirty year, semiannual bond. It is issued at par today. Interest rates remain at 6 percent for five years, and then GRADUALLY, over 5 years rises to 7%,
Campus food service case study : Provide examples that support why this student should not intentionally lie about these safety and health issues that were clearly violated.
At what value of z does e have its maximum value : What is the frequency of the small axial oscillations that the electron will undergo if it is free along the z-axis near the origin.
Barriers to identifying problems in the market : Explain three barriers that might cause the marketing executive to poorly identify the problem(s). An illustrative example in this context should be included for each barrier.

Reviews

Write a Review

 

Other Subject Questions & Answers

  Find out the enthalpy and internal energy at the final state

Do you think Julie should make changes to the products she offers? Based upon the case study, what accurately do you recommend that she should do? How might Julie be more certain that any actions she takes will more completely address the needs of th..

  Anti-social behavior in children psychologically

Do you believe anti-social behavior in children is psychologically based or psychologically illustrated?

  Discuss the benefits of training

Provide an overview of all the training methods and discuss their advantages and disadvantages Discuss the benefits of training

  Examining the personality of a person

A guy who lives alone tells everyone he is a rapper and a male model but never did either one. He gets fired from every job than spends his days and nights at the gym and night club.

  Adolescents to the young adult stages

This aligns with the process of development in which maturity occurs from adolescents to the young adult stages. I am interested to hear your take on this?

  Current ethical guidelines

How could you incorporate these different processes into your hypothetical study in a manner that complies with current ethical guidelines?

  Materials and processes in design

A modern new building project by an architectural consultancy requires that the interior contains some product designs. The building is an information centre that also houses a restaurant and a cafeteria. Most importantly, the consultancy wants yo..

  Boundaries-child phenomenon

How would you relate to a child who grows up with a parent with mental illness? Are these boundary issues the same? Why or Why not?

  Diagnosing a child with adhd

What factors and symptoms need to be considered before diagnosing a child with ADHD?

  Importance and uses of marketing and cross cultural research

Illustrate the merits and demerits of global promotional strategies?

  Judging alcohic american

He's Native American he's as well an alcoholic and will judge him in a manner that is consistent with that belief.

  Explain in detail a policy - program or system

Explain in detail a policy - program or system

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd