Convert decimal number in sixteen bit binary

Assignment Help Basic Computer Science
Reference no: EM1372076

1. Convert decimal number +25 and +3 in 16-bit binary.Show your work. Add the binary numbers in the above question using the rules for binary addition. Show your work. If 11 bits were used to represent a binary number,what is the largest number it could be stored in 11 bits?

Reference no: EM1372076

Questions Cloud

Strategies of organizational leadership : What is the relationship between gender roles and emotional labor in the workplace? Please give solid examples to support your response.
Create application which gets customer account data : Some interest Credit Company gives loans to customers at 1.5 percent interest per month. Create the application which gets customer account data which includes the account number, customer name, and balance due.
Functionalist view of social stratification : Explain the functionalist view of social stratification, and the conflict theory's view of social stratification.
Federal reserve selling bonds : Suppose if the Federal Reserve were to sell bonds, what would likely happen to money supply and interest rates? Explain it carefully.
Convert decimal number in sixteen bit binary : Convert decimal number +25 and +3 in 16-bit binary. Illustrate your work. Add binary numbers in above question using rules for binary addition.
Find maximum number of telephones in intermediate switch : Let a simple telephone network consisting of two end offices and one intermediate switch. Ten percent calls are long distance. Determine maximum no. of telephones an end office can support?
Illustrate that signature verification will succeed : If Bob receives M and S, describe process Bob will use to verify signature. Illustrate that in this case signature verification will succeed.
Draw block diagram of a communication channel : Explain the characteristics of electromagnetic waves and application to communications systems and determine the signal spectra for the content of complex waveforms
Gender socialization of children : Compare African-American, Latino and Asian-American families in terms of gender socialization of children and the influence of the multiple oppressions of race, gender, and social class.

Reviews

Write a Review

 

Basic Computer Science Questions & Answers

  Create application to declares array of ten houseplant

Design an application that declares an array of 10 HousePlants. Prompt the user for data for each of the HousePlants, then display all values.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Identify potential weaknesses of quality web design company

Identify potential weaknesses from either the Aircraft Solutions or Quality Web Design Company. In this phase, you will choose either Aircraft Solutions or Quality Web Design as the company you will work with.

  Describe why analyst needs to understand how people think

Describe why an analyst requires to understand how people think, how they learn, how they react to change, how they communicate, and how they work.

  Estimate maximum aggregate i-o transfer rate in system

Estimate the maximum aggregate I/O transfer rate in this system. Hint: Only one device at a time can be serviced on a selector channel.

  Technology someday eliminate need for antenna maintenance

What technology may someday eliminate this need for antenna maintenance? In your own words, briefly describe how this technology works.

  Better software tool internet explorer or mozilla firefox

There are several Internet browsers available today, and many people select which to use without giving it consideration. Explain which is better software tool: Internet Explorer, Mozilla Firefox, or Google Chrome?

  Construct a truth table for the boolean expression

Construct a truth table for the Boolean expressions ABC + A'B'C' ABC + AB'C' + A'B'C' A(BC' + B'C)

  Swimlane-hypothesis space

Assignment need to be done. It is about swimlane. I am attaching document and example of how it suppose to be done.

  Design patterns in today-s development environments

In System Analysis and Design: Design Patterns - How widely used are design patterns in today's development environments?

  How to solve performance problem of computer

Your friend recommends upgrading RAM to 256 MB to correct performance problems. Is there any other way to solve performance problem? Justify your answer.

  Estimate how much speedup would be gained from change

Suppose you are designing a computer system and are considering a change to your original design. Estimate how much speedup would be gained from this change. You must.show your work.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd