Body fat and diet program

Assignment Help Other Subject
Reference no: EM1361878

A 5'9", 140lb 32 year old female has a body fat percentage of 32% when measured using the BodPod. How accurate is her assessment? Where does she stand? Design a one week diet program to help her reach her goals.

Reference no: EM1361878

Questions Cloud

Create an abstract representation of a generic animal : Create an abstract representation of a generic Animal that has the at least two polymorphic methods for making a sound and showing the image of the animal.
Explain samsung electronic attempt to make profits : Explain Samsung Electronic attempt to make profits from rising consumer demand after the crash. Analyze how both companies attempted to make a profit after the crash
Making an investment with a return : Your firm's weighted average cost of capital is 11 percent. You believe the company should make a particular investment, but the IRR of this investment is only 9 percent.
Capital management practice analysis - automobile industry : Get a list of best practices for talent acquisition and the top five best human capital management practices within the automobile industry.
Body fat and diet program : A 5'9", 140lb 32 year old female has a body fat percentage of 32% when measured using the BodPod. How accurate is her assessment? Where does she stand? Design a one week diet program to help her reach her goals.
What is the speed of lander just before it touches surface : Three astronauts, propelled by jet backpacks, push and guide a 114 kg asteroid toward a processing dock, exerting the forces, with F1 = 32 N, F2 = 52 N, F3 = 39 N, θ1 = 30°, and θ3 = 60°. What is the (a) magnitude and (b) angle (measured relative ..
Multiple regression model and independent variables : Propose a business problem that would be best solved by multiple regression analysis. How would you evaluate the quality of the multiple regression model?
Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?
Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Reviews

Write a Review

 

Other Subject Questions & Answers

  Disorders in the course of your diagnosis

You should be able to rule out several other disorders in the course of your diagnosis.

  What is the range of body fat

If the ideal percent body fat for an acceptable male is 18-24 percent. If a male student weighs 190 pounds, what is the range of body fat (in pounds) needed to match the ideal.

  Administration of jails and prisons

How have the courts affected inmate population and the administration of jails and prisons? Is cynicism common in corrections?

  Stress and drug addiction

I am doing an assignment on the link between stress and drug addiction. Can you provide me with an article describing this relationship?

  High-intensity exercise of equal total caloric expenidture

Why does regular low-intensity exercise stimulate greater body fat loss than high-intensity exercise of equal total caloric expenidture?

  Status of facility employees

Consider the status of facility employees in terms of level of pay, training, duties, and liability.

  Explaining the insanity defense

How often is the insanity defense used and how successful is it?

  Ucc and secured transanctions

What part of the UCC governs secured transactions?

  Physical and psychological distress

The relationship between depression and substance abuse are common stressors that cause physical and psychological distress.

  Memory-perception-retrieval

Describe primary memory? What are the characteristics of primary memory?

  Question regarding deductive and inductive reasoning

Describe the distinction between deductive and inductive reasoning?

  Description of the sub-population of inmates

A brief description of the sub-population of inmates for whom you selected assessment instruments.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd